Expression Database

MaProbe Details
Probe ID maprobe:5764
   
Name of cDNA A630001G21
   
Sequence ID:
   
Gene
Symbol: A630001G21Rik
Name: RIKEN cDNA A630001G21 gene (MGI:2443131)
   
5' primer sequence CACAATTGACGCCCGCCG
   
3' primer sequence TAATACGACTCACTATAGGGACAATCGCACGGATGGAG
   
5' primer location 44
   
3' primer location 543
   
Origin of Clone used to make the Probe
Strain: C57BL/6
Tissue: brain
   
Probe Type RNA
   
Curator Notes
   
ISH Data
GUDMAP:12937 TS23 male wholemount
GUDMAP:12938 TS23 female wholemount
   

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development