Expression Database

MaProbe Details
Probe ID maprobe:5476
   
Name of cDNA A630052D16
   
Additional Name of cDNA MSR0229
   
Sequence ID:
   
Gene
Symbol: Ccr4
Name: chemokine (C-C motif) receptor 4 (MGI:107824)
   
5' primer sequence ATGAATGCCACAGAGGTC
   
3' primer sequence TAATACGACTCACTATAGGGCTCATTCTTGCAGTGTTGC
   
5' primer location 108
   
3' primer location 812
   
Origin of Clone used to make the Probe
Strain: C57BL/6
Tissue: brain
   
Probe Type RNA
   
Curator Notes
   
ISH Data
GUDMAP:11223 TS23 male wholemount
GUDMAP:11259 TS23 female wholemount
   

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development