Expression Database

MaProbe Details
Probe ID maprobe:4997
   
Name of cDNA 1700023B02
   
Sequence ID:
   
Gene
Symbol: Cir1
Name: corepressor interacting with RBPJ, 1 (MGI:1914185)
   
5' primer sequence AGAAGACCCTGAAGTTGA
   
3' primer sequence TAATACGACTCACTATAGGGTTCACCATGGCTTCTGGT
   
5' primer location 631
   
3' primer location 1339
   
Origin of Clone used to make the Probe
Strain: C57BL/6
Tissue: brain
   
Probe Type RNA
   
Curator Notes
Symbol changed from 1700023B02Rik to Cir1
   
ISH Data
GUDMAP:10200 TS23 male wholemount
GUDMAP:10220 TS23 female wholemount
GUDMAP:10290 TS23 male wholemount
GUDMAP:10291 TS23 female wholemount
   

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development