Expression Database

MaProbe Details
Probe ID MGI:1897489 (maprobe:4223)
   
Name of cDNA RIKEN clone 2810012H16
   
Sequence ID:
   
Gene
Symbol: Wnt4
Name: wingless-related MMTV integration site 4 (MGI:98957)
   
5' primer sequence GCGTAGCCTTCTCACAGTCC
   
3' primer sequence CGATGTTAATACGACTCACTATAGGGCTTGAGGACCCAAAAACCAA
   
5' primer location 653
   
3' primer location 1351
   
Origin of Clone used to make the Probe
Strain:
Tissue:
   
Probe Type RNA
   
Curator Notes
   
ISH Data
GUDMAP:7155 TS17 unknown sex visceral organ wholemount
GUDMAP:7157 TS20 male testis... wholemount
GUDMAP:7158 TS20 female paramesonephric duct of female, rest of... wholemount
GUDMAP:7160 TS20 female urogenital mesentery... wholemount
GUDMAP:7159 TS21 male nephric duct of male, rest of... wholemount
GUDMAP:13785 TS21 unknown sex primitive bladder... section
GUDMAP:7156 TS23 unknown sex metanephros... section
GUDMAP:7466 TS23 unknown sex bladder section
GUDMAP:8208 TS23 unknown sex ureter... section
GUDMAP:8209 TS23 unknown sex metanephros... section
GUDMAP:13784 TS23 male bladder... section
GUDMAP:14182 TS25 unknown sex metanephros section
GUDMAP:13629 TS27 male bladder section
GUDMAP:14081 TS27 unknown sex metanephros section
GUDMAP:14082 TS27 unknown sex metanephros section
GUDMAP:14083 TS27 unknown sex metanephros section
GUDMAP:14084 TS28 unknown sex metanephros section
   

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development