Expression Database

Data Source
   
Gene
Slc22a6   solute carrier family 22 (organic anion transporter), member 6
   
Theiler Stage TS28
   
Tissue metanephros
   
Images
Metanephros sectioned through inner medulla and pelvis.
Renal cortex.
Renal cortex and outer stripe of outer medulla.
Renal cortex - expression in a subset of proximal convoluted tubule.
Outer stripe of outer medulla.
Inner stripe of outer medulla.
Inner medulla and pelvis.
   
Submitters
Principal Investigator(s): Melissa H Little, University of Queensland, Brisbane, Australia, m.little@imb.uq.edu.au
Authors: Sean Grimmond, Dave Tang, Rathi Thiagarajan, Kylie Georgas, Melissa Little, Han Sheng Chiu, Divya Ramanth, Bree Rumballe
Submitted By: Kylie Georgas, University of Queensland, Brisbane, Australia, k.georgas@imb.uq.edu.au
Archive ID: 230
Submission ID: 9999991900
   
Expression Mapping

Expression Strengths Key:
Present (unspecified strength)
Present (strong)
Present (moderate)
Present (weak)
Uncertain
Not Detected
   
Expression Patterns Key:
Homogeneous
Graded
Regional
Spotted
Ubiquitous
Restricted
Single cell
Contains note
View annotated components as a list Show annotation under groups information
Javascript Tree Menu  
   
Probe
Gene:
Symbol: Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6 (MGI:892001)
Probe ID: MGI:2400327 (maprobe:4755)
Name of cDNA: RIKEN clone 9630022J22
Sequence ID:
AK035971.1
5' primer sequence: AGCACTAAAGGGAGTGGGGT
3' primer sequence: CGATGTTAATACGACTCACTATAGGGGAGCAACGTTGAAAACCCAT
5' primer location: 1777
3' primer location: 2355
Origin of Clone used to make the Probe:
Strain: unspecified
  Tissue:
Probe Type: RNA
Type: antisense
Labelled with: digoxigenin
Visualisation method: alkaline phosphatase + BM purple
Lab Probe ID: 1962
Probe Notes: Riboprobe generated from a PCR-generated DNA template. The details of the PCR protocol are in the Project Protocols under the Research menu of the website. Primers are designed to amplify a 3'UTR region of the gene of between 500-700bp. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
   
Specimen
Theiler Stage: TS28
Other Staging System: Adult sexually mature
Tissue: metanephros
Strain: CD1
Genotype: Wild type
Sex: unknown
Specimen Preparation:
section
Fixation Method: 4% paraformaldehyde
Embedding: paraffin
Experiment Notes:
7µm sections 4 sections examined including metanephros. Experiment: SISH281107 1962 SISH Slide B15. Gene identified as early proximal tubule specific in the developing kidney via microarray analysis of Brunskill et al, 2009 microarray data performed by Rathi Thiagarajan. Imaging: Batch Scan 04-12-07 Image_26.vsi. Colour development: This gene was colour developed for 120hrs. Control probe Wnt4 on TS23 metanephros colour developed for 29hrs. Shh weak expressing control probe colour developed for 120hrs. Moderate Shh expression signal was detected therefore low levels of mRNA expression should be detectable in this experiment.
  
Linked Publications
   
Linked Submissions
   
Acknowledgements

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development