Expression Database

Data Source
   
Gene
Fbp2   fructose bisphosphatase 2
   
Theiler Stage TS23
   
Tissue metanephros
   
Images
Metanephros sectioned through pelvis and ureter - expression in subset of early proximal tubule.
Nephrogenic zone and cortex - note expression detected in presumptive S1 early proximal tubule adjacent to renal corpuscle.
Nephrogenic zone and cortex.
Metanephros sectioned through medulla.
Nephrogenic zone through to medulla (left). Expression in immature loop of Henle subset.
Nephrogenic zone and cortex.
Cortex and medulla (right). Expression in presumptive proximal straight tubule and subset of adjacent immature loop of Henle.
Metanephros sectioned through pelvis.
Metanephros sectioned through pelvis.
Cortex through to pelvis (lower left) - expression in subset of immature loop of Henle.
Cortex and medulla (top) - expression in subset of immature loop of Henle adjacent to the proximal tubule, presumptive S3 straight segment.
Metanephros sectioned through pelvis.
Cortex - note expression in presumptive S1 segment of early proximal tubule adjacent to renal corpuscles of some but not all nephrons (centre). This may reflect the maturation of the different nephrons.
   
Submitters
Principal Investigator(s): Melissa H Little, University of Queensland, Brisbane, Australia, m.little@imb.uq.edu.au
Authors: Sean Grimmond, Dave Tang, Rathi Thiagarajan, Kylie Georgas, Melissa Little, Han Sheng Chiu, Divya Ramanth, Bree Rumballe
Submitted By: Kylie Georgas, University of Queensland, Brisbane, Australia, k.georgas@imb.uq.edu.au
Archive ID: 214
Submission ID: 9999991556
   
Expression Mapping

Expression Strengths Key:
Present (unspecified strength)
Present (strong)
Present (moderate)
Present (weak)
Uncertain
Not Detected
   
Expression Patterns Key:
Homogeneous
Graded
Regional
Spotted
Ubiquitous
Restricted
Single cell
Contains note
View annotated components as a list Show annotation under groups information
Javascript Tree Menu  
   
Probe
Gene:
Symbol: Fbp2
Name: fructose bisphosphatase 2 (MGI:95491)
Probe ID: MGI:3571926 (maprobe:6042)
Name of cDNA: RIKEN clone I920078I07
Sequence ID:
AK146946.1
5' primer sequence: CCCTCTGGATGGATCTTCAA
3' primer sequence: CGATGTTAATACGACTCACTATAGGGCTGTGGTTGCCATACCTCCT
5' primer location: 483
3' primer location: 1021
Origin of Clone used to make the Probe:
Strain: unspecified
  Tissue:
Probe Type: RNA
Type: antisense
Labelled with: digoxigenin
Visualisation method: alkaline phosphatase + BM purple
Lab Probe ID: 3020
Probe Notes: Riboprobe generated from a PCR-generated DNA template. The details of the PCR protocol are in the Project Protocols under the Research menu of the website. Primers are designed to amplify a 3'UTR region of the gene of between 500-700bp. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
   
Specimen
Theiler Stage: TS23
Other Staging System: 15.5dpc
Tissue: metanephros
Strain: CD1
Genotype: Wild type
Sex: unknown
Specimen Preparation:
section
Fixation Method: 4% paraformaldehyde
Embedding: paraffin
Experiment Notes:
10 metanephros and 2 ureter sections examined. Experiment: SISH101109 Probe ID 3020. Imaging: Batch scan 17-11-09 Image_16.vsi. Colour developed for 70hrs. Control probes Wnt4, Wnt7b and Shh colour developed for 47, 47 and 70 hrs respectively. Shh expression was not detected therefore low levels of mRNA expression will not be detected for SISH performed in this experiment. Gene identified as early proximal tubule specific via microarray analysis of Brunskill et al, 2009 microarray data performed by Rathi Thiagarajan.
  
Linked Publications
   
Linked Submissions
   
Acknowledgements

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development