Expression Database

GUDMAP:11371
Data Source
   
Gene
Dll1   delta-like 1 (Drosophila)
   
Theiler Stage TS23
   
Tissue metanephros
   
Images
Metanephros sectioned through pelvis.
Nephrogenic zone and cortex (top) - note expression in medial segment of S-shaped body.
Pelvis (top) and medulla.
NZ and cortex - moderate expression in pretubular aggregate (left), strong expression renal vesicle (top right).
Metanephros sectioned through pelvis.
NZ and cortex - note expression in upper limb of comma-shaped body (lower left).
NZ and cortex - expression in upper comma-shaped body, distal renal vesicle, medial S-shaped body and cortical renal tubule of capillary loop nephron.
NZ and cortex.
NZ and cortex - note expression in anlage of loop of Henle of capillary loop nephron (centre).
NZ and cortex - note expression in distal renal vesicles.
NZ and cortex - note expression in distal renal vesicle and regional expression in a small segment of the cortical renal tubules of capillary loop stage nephron (centre top).
Metanephros sectioned through ureter.
Proximal ureter.
   
Submitters
Principal Investigator(s): Melissa H Little, University of Queensland, Brisbane, Australia, m.little@imb.uq.edu.au
Authors: Bruce Aronow, Dave Tang, Han Sheng Chiu, Kylie Georgas, Sean Grimmond, Rathi Thiagarajan, Emmanuelle Lesieur, Bree Rumballe, Melissa Little
Submitted By: Kylie Georgas, University of Queensland, Brisbane, Australia, k.georgas@imb.uq.edu.au
Archive ID: 158
Submission ID: 99999995
   
Expression Mapping

Expression Strengths Key:
Present (unspecified strength)
Present (strong)
Present (moderate)
Present (weak)
Uncertain
Not Detected
   
Expression Patterns Key:
Homogeneous
Graded
Regional
Spotted
Ubiquitous
Restricted
Single cell
Contains note
View annotated components as a list Show annotation under groups information
Javascript Tree Menu  
   
Probe
Gene:
Symbol: Dll1
Name: delta-like 1 (Drosophila) (MGI:104659)
Probe ID: maprobe:5538
Name of cDNA: 1200004G03
Sequence ID:
NM_007865.3
5' primer sequence: CTAGAACACTCTGGGAGCGG
3' primer sequence: CGATGTTAATACGACTCACTATAGGGTCTTCAAAGACCCAGGGATG
5' primer location: 28
3' primer location: 535
Template Sequence: (Click to see sequence.)
Origin of Clone used to make the Probe:
Strain:
  Tissue:
Probe Type: RNA
Type: antisense
Labelled with: digoxigenin
Visualisation method: alkaline phosphatase + BM purple
Lab Probe ID: 2246
Probe Notes: Riboprobe generated from a PCR-generated DNA template. The details of the PCR protocol are in the Project Protocols under the Research menu of the website. Primers are designed to amplify a 3'UTR region of the gene of between 500-700bp. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
   
Specimen
Theiler Stage: TS23
Other Staging System: 15.5dpc
Tissue: metanephros
Strain: CD1
Genotype: Wild type
Sex: unknown
Specimen Preparation:
section
Fixation Method: 4% paraformaldehyde
Embedding: paraffin
Experiment Notes:
7µm sections 21 sections examined including metanephros and proximal ureter. Experiment: SISH100908 Dll1 2246 Slide A5. Imaging: Batch Scan 190908 Image_48.vsi. Bruce Aronow and Melissa Little analysis of developing 15.5dpc kidney microarray data (Brunskill et al 2008) - Putative distal renal vesicle subcompartment.
  
Linked Publications
   
Linked Submissions
Database: GUDMAP
Accession ID Link Type(s)
GUDMAP:11372 same experiment  same probe  same specimen 
   
Acknowledgements

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development