Expression Database

GUDMAP:13649
Data Source
Gene
Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide
Theiler Stage TS23
Tissue male reproductive system
Images
Lower urinary tract - sagittal section through bladder and external genitalia. Bladder is annotated in a separate submission.
External genitalia.
Base of the genital tubercle (left) and adjacent labioscrotal swelling. Strong expression in a restricted region of the mesenchyme (centre) of the male external genitalia. The identity of this mesenchyme is uncertain. Note also the restricted expression in the superficial surface epithelium of the external genitalia.
Submitters
Principal Investigator(s): Melissa H Little, University of Queensland, Brisbane, Australia, m.little@imb.uq.edu.au
Authors: Sean Grimmond, Dave Tang, Rathi Thiagarajan, Kylie Georgas, Melissa Little, Han Sheng Chiu, Divya Ramanth, Bree Rumballe
Submitted By: Kylie Georgas, University of Queensland, Brisbane, Australia, k.georgas@imb.uq.edu.au
Archive ID: 222
Submission ID: 9999991799
Expression Mapping

Expression Strengths Key:
Present (unspecified strength)
Present (strong)
Present (moderate)
Present (weak)
Uncertain
Not Detected
   
Expression Patterns Key:
Homogeneous
Graded
Regional
Spotted
Ubiquitous
Restricted
Single cell
Contains note
View annotated components as a list Show annotation under groups information
Javascript Tree Menu  
Probe
Gene:
Symbol: Atp1b1
Name: ATPase, Na+/K+ transporting, beta 1 polypeptide (MGI:88108)
Probe ID: MGI:1895468 (maprobe:6063)
Name of cDNA: RIKEN clone 2410046B18
Sequence ID:
AK010677.1
5' primer sequence: AGGCAGCTGGAAGAAATTCA
3' primer sequence: CGATGTTAATACGACTCACTATAGGGCAACACTCGGTTGAGCTTGA
5' primer location: 526
3' primer location: 1051
Origin of Clone used to make the Probe:
Strain: unspecified
  Tissue:
Probe Type: RNA
Type: antisense
Labelled with: digoxigenin
Visualisation method: alkaline phosphatase + BM purple
Lab Probe ID: 2842
Probe Notes: Riboprobe generated from a PCR-generated DNA template. The details of the PCR protocol are in the Project Protocols under the Research menu of the website. Primers are designed to amplify a 3'UTR region of the gene of between 500-700bp. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
Specimen
Theiler Stage: TS23
Other Staging System: 15.5dpc
Tissue: male reproductive system
Strain: CD1
Genotype: Wild type
Sex: male
Specimen Preparation:
section
Fixation Method: 4% paraformaldehyde
Embedding: paraffin
Experiment Notes:
Lower urinary tract - embryos were dissected below the forelimb buds, internal organs removed except the lower urinary tract and sectioned sagittally. Male and female embryos were examined. Bladder, urethra and external genitalia were examined. This submission examines the male reproductive system organs and a separate submission examines the male urinary system organs. Experiment: SISH160909 Probe ID 2842. Imaging: Batch scan 23-09-09 Image_26.vsi. Colour developed for 26hrs. Female and male LUTs were examined (see related data submissions).
Linked Submissions
Database: GUDMAP
Accession ID Link Type(s)
GUDMAP:13650 same embryo  same experiment  same probe 
GUDMAP:13651 same experiment  same probe 
GUDMAP:13652 same experiment  same probe 

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development