Expression Database

GUDMAP:13470
Data Source
Gene
Btc betacellulin, epidermal growth factor family member
Theiler Stage TS23
Tissue bladder
Images
Lower urinary tract - low magnification image. Genital tubercle and labioscrotal swelling (centre left) and bladder and pelvic urethra (top centre). No expresion in pelvic urethra (below bladder) or phallic urethra (within genital tubercle, synonym urethral epithelium / urethral plate). Weak surface expression in surface epithelium of external genitalia and skin surface epithelia of embryo.
Bladder - low magnification image.
Lower urinary tract - overview image.
Lower urinary tract - low magnification image. Lower half of embryo with lower urinary tract retained, sagittal section. Bladder (centre right).
Bladder - low magnification image.
Bladder - high magnification image - no expression seen in the bladder.
Submitters
Principal Investigator(s): Melissa H Little, University of Queensland, Brisbane, Australia, m.little@imb.uq.edu.au
Authors: Dave Tang, Bree Rumballe, Divya Ramanth, Melissa Little, Han Sheng Chiu, Kylie Georgas
Submitted By: Divya Ramnath, The University of Queensland, Brisbane, Australia, d.ramnath@imb.uq.edu.au
Archive ID: 212
Submission ID: 9999991485
Expression Mapping

Expression Strengths Key:
Present (unspecified strength)
Present (strong)
Present (moderate)
Present (weak)
Uncertain
Not Detected
   
Expression Patterns Key:
Homogeneous
Graded
Regional
Spotted
Ubiquitous
Restricted
Single cell
Contains note
View annotated components as a list Show annotation under groups information
Javascript Tree Menu  
Probe
Gene:
Symbol: Btc
Name: betacellulin, epidermal growth factor family member (MGI:99439)
Probe ID: MGI:2390432 (maprobe:5982)
Name of cDNA: RIKEN clone 4632406O07
Sequence ID:
AK076272.1
5' primer sequence: CAACCAAACAAGCAAGCAAA
3' primer sequence: CGATGTTAATACGACTCACTATAGGGGAACGAAAACCCACCTTTCA
5' primer location: 1211
3' primer location: 1727
Origin of Clone used to make the Probe:
Strain: unspecified
  Tissue:
Probe Type: RNA
Type: antisense
Labelled with: digoxigenin
Visualisation method: alkaline phosphatase + BM purple
Lab Probe ID: 2815
Probe Notes: Riboprobe generated from a PCR-generated DNA template. The details of the PCR protocol are in the Project Protocols under the Research menu of the website. Primers are designed to amplify a 3'UTR region of the gene of between 500-700bp. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
Specimen
Theiler Stage: TS23
Other Staging System: 15.5dpc
Tissue: bladder
Strain: CD1
Genotype: Wild type
Sex: female
Specimen Preparation:
section
Fixation Method: 4% paraformaldehyde
Experiment Notes:
Lower Urinary Tract - Caudal half embryos with lower urinary tracts intact were sectioned sagittally - sections - 6 sections examined. Experiment: SISH280909 Probe ID 2815 Slide ID C2. Gene identified as specific to the urothelium layer of bladder in collaboration with Jim Lessard. Colour development for 140hrs. Control probes Myh11, Upk3a, Wnt4 and Shh colour developed for 22 ,22, 69 and 140 hrs respectively. Imaging: Image_20.vsi from Batch Scan 15-10-09.

 

Disclaimer: Please note that the development of the GUDMAP website is an on-going process. Whilst we make every effort to ensure the quality of the information on these pages, the content cannot always be guaranteed to be accurate or complete. In addition, at certain times some functions may be restricted.
Department of Health and Human Services National Institutes of Health Contacts Citing GUDMAP National Institute of Diabetes and National Institute of Child Health and Human Development